
Thermo Scientific™ Primers voor cDNA-synthese

Optimze cDNA synthesis with these random hexamer primers, oligo(dT)18 primers and anchored oligo dT primers. Random Hexamer Primer, 100 µM, 120 µl

Applied Biosystems™ Random Hexamers (50mM)

Serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase Random Hexamer Primers Each

Applied Biosystems™ 5' Fluorescent Labeled Single Primers

Custom 5' labeled primers are fluorescently labeled oligos with a choice of dye on the 5' end TA PCRII DUAL PROMOTER

Invitrogen™ Random Primers

Truly random primers suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates RANDOM PRIMERS,1.5MM, 100 UL (~297UG/100 UL)

Applied Biosystems™ Oligo d(T) 16 (50mM)

Used for priming and reverse transcription of polyadenylated (poly A+) mRNA Oligo d(T)16 (50 µ M)

Thermo Scientific™ Oligo(dT)18-primers

Thermo Scientific™ Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. Oligo(dT)18 Primer, 100 µM,120 µl

Invitrogen™ pUC19 DNA (Sau3A I digested)

Ambion pUC 19 DNA is digested to completion with Sau3A I Puc19 DNA-Sau3A I Digstd 50Ug (0.5 Mg/ml)

Invitrogen™ Random Decamers (50μM)

Provided at a stock concentration of 50μM, and functionally tested using the RETROscript™ Kit 50 Um Decamers 80 Ul (Retro) Each

Invitrogen™ T7 Promoter Primer

Primers for PCR amplification that complement many vectors 2UG PRIMER, T7

Invitrogen™ 5-(3-Aminoallyl)-UTP (50mM)

Ambion Modified nucleotides confer unique characteristics to the RNA molecules into which they are incorporated 50Mm 5-(3-Aminoallyl)-Utp 50Ul Each

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 promoter sequencing primer, 5'-d(GCGCGAAATTAACCCTCACTAAAG)-3', 10 µM, 4.2 nmol

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. pJET1.2 rev. sequencing primer,5'-d(AAGAACATCGATTTTCCATGGCAG)-3', 10 µM, 8.4 nmol

Invitrogen™ M13 Forward (-20)

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13(-20)FORWARD

Thermo Scientific™ M13/pUC primer voor omgekeerde sequentie (-26), 17-mer

Sequence DNA fragments inserted into the MCS of various pUC19-based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/pUC reverse sequencing primer (-26), 5'-d(CAGGAAACAGCTATGAC)-3', 10 µM, 6nmol

Invitrogen™ 5-(3-Aminoallyl)-dUTP (50mM)

When incorporated into DNA, 5-(3-aminoallyl)-dUTP provides a reactive group for addition of other chemical groups 50Mm 5-(3-Aminoallyl)-Utp 5Ul Each

Thermo Scientific™ Exo-Resistant Random Primer

Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. Exo-Resistant Random Primer, 5'-NpNpNpNpNpSNpSN-3', 500 µM, 100 µl

Invitrogen™ Bio-16-UTP (10mM)

Ideal for use as substrates as part of in vitro transcription reactions 10 Mm Bio-16-Utp 1 Tube Each

Invitrogen™ RNA Century™-Plus Marker Templates

Contain mixtures of linearized plasmids ready for use as templates during in vitro transcription reactions for synthesis of labeled RNA molecular size standards RNA Century Mrkr Temp Plus 5Ug (0.5 Mg/ml)

Thermo Scientific™ M13/pUC sequencing primer (-46), 22-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/pUC sequencing primer (-46), 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3', 10 µM, 4.5 nmol

Invitrogen™ Bio-11-UTP (75mM)

Ideal for use as substrates as part of in vitro transcription reactions 75 Mm Bio-11-Utp 1 Tube Each

Invitrogen™ Oligo(dT) 12-18 Primer

Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase OLIGO(DT)12-18 PRIMER, 25 UG

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 promoter sequenc. primer, 20-mer, 5'-d(TAATACGACTCACTATAGGG)-3', 10 µM, 5 nmol

Invitrogen™ M13 Reverse

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13 REVERSE

Invitrogen™ Oligo(dT) 20 Primer

Used for first-strand cDNA synthesis with reverse transcriptase at temperatures of ≥50°C OLIGO DT(20) PRIMER, 50 UMOL/15UG

Thermo Scientific™ M13/pUC sequencing primer (-40), 17-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/pUC sequencing primer (-40), 17-mer, 5'-d(GTTTTCCCAGTCACGAC)-3', 10 µM, 6nmol

Invitrogen™ Oligo (dT) Primer (50mM)

Provided at a stock concentration of 50μM Oligo(Dt) Primer (50 Um) 80Ul (Retro)

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 promoter sequencing primer, 5'-d(ATTTAGGTGACACTATAG)-3', 10 µM, 5.6 nmol

Invitrogen™ Lambda Hind III dsDNA Markers

Ambion Lambda DNA is digested to completion with Hind III Lambda DNA-Hindiii Dgstd 200Ug (0.5 Mg/ml)

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 promoter sequencing primer, 17-mer, 5'-d(ATTAACCCTCACTAAAG)-3', 10 µM, 6 nmol

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 promoter sequencing primer,5'-d(CATACGATTTAGGTGACACTATAG)-3', 10 µM, 4.2 nmol
